СЕКРЕЦИЯ В ПЕРИПЛАЗМУ РЕКОМБИНАНТНОГО ЭПИДЕРМАЛЬНОГО ФАКТОРА РОСТА ЧЕЛОВЕКА В КЛЕТКАХ ESC 11 Е R I ( II / А С О L I

Читать онлайн: 
Текст статьи: 

БИООР ГАНИЧ Е С КАЯ ХИМИЯ
Т ем 18 * № б * 1992
У Д К 577.122
© 1092 r. II. 11. Патчикова, 1-1. />. Альтман, С. В. Луценко,
П. А. Смирнов, И. В. Назимов*, Л. Г. Эгикиий,
К. А. Сииягииа, А. В. Ажаев
Совместное малое предприятие ьХимтек»,
* Институт биооргаиичеспоц. химии им М. М. Шемякина Р. 1 //. Мосива
Сконструирована серия ескроциошшх вектором. п которых сиптотичоекой ген
■ птдермального фактора роста чи.чщшиа (liEGI'), t-.остi.int»на>1 1гbiii с. геном, кодирую
щ и м лидерныи пептид одного п.ч основных белком «пешней меж) раны /С coli, Ompl',
находится пол, контролем промотора Сы,;. Повышение выхода нелепого продукта Д о стигается
путем увеличении копий рекомбинантного гена. 15 бактериальных клетках
hKC.l' секретнруется в перинлазматнческое пространство. Целевой белок выделен в
систол н и it. близком к гомогенному (>!)8%) с использованием ОФ-хроматографнн.
Пыход составил 7 мг/л бактериальной культуры. \-Кппцевая нмшткпелотнаи последовательность
(25 аминокислот) подученного liEGI' соответствует природной. Препарат
обладает биологической активностью.
Эпидермальный фактор роста человека ( Ь E G K ) . 0 1 1 же урогастрон,
у ч а с т в у е т в ряде, физиологических процессов, с вязанных с эмбриональным
ростом и регенерацией тканой [1 ].
11 1'ХдК представляет собой полипептид, состоящий из Г).'-! аминокислотных
остатков и содержащим 3 дпеульфпдиые связи. Нансе [2 ] мы осуществили
хилшко-формеитативиыи синтез гена It l iG K с учетом наиболее
часто используемых в K .c o l i кодонов. Синтетический ген l iE G P . содержащий
'1135 нуклеотидных пар (5.'! кодона аминокислот и 2 стоп-кодона) и
имеющий «липкие концы» сайтов рестриктаз E c o R f ( У ) и В а т [ I ! (3 ' ) ,
был клонирован в составе pUC'18. При атом ген l iK G K попадает в рамку
счи ты в ан ия ¡5-галактозидазы, и плазмида p U C 1 S/li KG К кодирует JilC G P n
составе гибридного белка с 5 аминокислотными остатками {5-гадактози-
дазы па N -конце. В клетках E . coli J.VH05, трансформированных этой
плазмидой, выращенных в присутствии 1НТС, целевой продукт не обнар
уж и в а е т с я (данные не о п уб л и ко в аны ) . Причиной, но-видимому, я в л я ется
известная нестабильность чужеродного н и з комол е ку л я рпого белка в
клетках E . coli при продукции его в цитоплазму.
Стабильность чужеродного полипептида в клетках E . coli может быть
повышена путем выведения целевого продукта из зоны действия цитоплазматических
иротеиназ, т. е. с помощью секреции его в периплазма-
тичеекое пространство или в к ул ь т ур а л ьн ую среду.
Н а с то ящ ая работа посвящена экспрессии гена h E G K в составе секре-
.ционпых векторов, содержащих ген лидерного пептида белка О mp К, «дно-
14) из основных белков внешней мембраны E . coli.
Ген о/прЕ представлен в хромосоме E . coli одной копией и находится
код контролем сильного индуцируемого промотора со сложной системой
Сокращения: hEGK - эпидермальный фактор роста человека; IРТС и ¡«тропил
^-/Жгиогалактозпд, ОФ - обращепно-фазовая, МВ- яуклеаза - нуклеаза золотистой фу
соли (ui ung Ьеап), префикс «d» в формулах олигодезоксирлбоиуклеотидов опущен
766
Ps t I
D-----
мРНК
/40 n.o. Sau ЗА f0 n.o. Pst I
Рви 140 п.0. Sau3 A
W/ / 7 7 A
Sau ЗА 40 n.o. AAGECTGCAGAA _ ■ - \ut!!ll}niUUl"!UlUHmZzA
TTGCGACGTCTT
p[lZI80elRl-Saudf\lPstI <¿40»
PSt I
Sau3A
- bzzzzzzzzgs
AAC&CT GCA
'xrnnzzzA
T T G C G
фр а гме нт
П п е н о В а
Sou3k AACGC
■ - 'v ln /!/} ) l)l/lll/ll>!!>lh///niL\
TTGCG
олигонуклеотид (П),
Ш-лигаза
Sou ЗА A A C G C G A A T T C
-------- bzzzzzzzzagTZZZgzzzzzzzzzzd
T T G - C G C T T A A G
pUC iSctel RI-S au ЗА I £co RI «4 0»
В е к т о р pU С 18/E со R I IPStl
сррагмент
P s t l ~ Sau ЗА »140»
сррагмент
Sau 3A-EcoftI 40$
Sau 3/\
Eco RI
Т Ч - л и г а з а
р и с 1 8-йтрНР&И1ЕсоЯ1)
Рис. 1. Схема конструирования илазмнды риС18-ОтрР/Р«г1/ЕсоШ из фрагмента
РяП-РьП гена отрР. Заштрихована последовательность, кодирующая лидерный пептид
ОшрР; пунктиром обозначена Д Н К векторных плазмид
регуляции [3 -6 ] . На эффективность его экспрессии влияет ряд факторов
культуральной среды, например осмос, pH и температура. При полной индукции
синтез белка ОтрК достигает примерно 105 молекул на клетку [б]*
что, по-видимому, объясняется не только силой промотора, но и приспособленной
к высокой экспрессии областью инициации трансляции. Нуклеотидная
последовательность гена от р Р известна [5]. Участок, кодирующий
5'-конец о т р р мРНК от старта транскрипции до места стыка кодонов
лидерного пептида и зрелой части белка, находится в составе
Р^Ь/^гГ-фрашента (180 н.о.) этого гена. Таким образом, легко осуще767
ствляется стыковка чужеродного гена с геном лндерного пептида OmpF
я всего гибридного гена под контроль сильного регулируемого промотора
Е. roll, который более удобен в работе по сравнению с промотором OmpF.
Указанный фрагмент был выделен нами из хромосомы K. coli штамм»
С600. Далее дистальный (по ходу трансляции) сайт PstI был заменен
нами на сайт Есо)\ I (плазмида pUC18-OmpF (Pstl/Ecoïil) (см. рис. 1 и
«Экспериментальную часть») так, чтобы при последующем лигировании
по сайту EeoRl синтетический ген heg) попадал в рамку считывания ли-
дерного пептида Om pF. При этом первый кодон гена h EG К точно стыкуется
с последним кодоном гена лндерного пептида.
В качестве вектора использована плазмида pKKD, содержащая промотор
Р,ос, полилинкерный участок и терминатор транскрипции гена ггпВ.
которая представляет собой модифицированную нами коммерческую плазмиду
рКК223-3 (Pharmacia). Модификация заключалась в элиминации
сайтов рестриктаз ВатШ. и Sail в составе участка, происходящего из
pBR322, а также в замене части полилинкера на синтетическую последовательность,
в которой вместо сайтов рестриктаз /icoBl, 5 mal, ßamHl и
SalI появляется сайт Xkol, при этом сайты Ра/А и //¿/idIII сохраняются.
Плазмида pBT-hEGF, схема которой представлена на рис. 2, получена
трехкомпонентным лигированием фрагмента Pstl-EcoWl (участок гена
ompF), фрагмента EcoÎ\l-Hlnàl\l из pUC18-hEGF (ген hegf) и векторного
фрагмента Pstl-HinAlll из pKKD. Штамм E. coli JM105, трансформиро
ванный плазмидой pBT-hEGF, выращивали в условиях индукции tac-про
мотора в минимальной среде. В качестве контроля использовали штамм
3М105, трансформированный плазмидой рКKl). Из клеток указанных
штаммов получали перинлазматические фракции (см. «Экспериментальную
часть») и анализировали их с помощью SDS-гель-электрофореза. Пак
видно из рис. 3, в препарате, полученном из клеток, содержащих плазмиду
pBT-hEGF, присутствует дополнительная полоса с молекулярной мае
сой примерно 7 кДа, что соответствует hEGF. Присутствие hEGF-имму
нореактивного материала в периплазматической фракции белков опытного
штамма обнаруживается также dot-методом с помощью антител на
hEGF. По данным иммуноферментного анализа, проводимого с помощью
поликлональных антител на hEGF, продукция hEGF в периплазму клеток
штамма JM105/pBT-hEGF составляет 3,5—4,5 мг/л бактериальной
культуры.
Целевой белок был выделен из периплазматической фракции клеток
штамма JM105/pBT-hEGF в аналитических количествах путем сорбции на
мини-колонке с SepPack С18 и ВЭЖХ. N Концевая аминокислотная но
следовательность выделенного белка совпадает с соответствующей последовательностью
hEGF.
Полученный результат свидетельствует о том, что гибридный белок
предшественник, кодируемый плазмидой pBT-hEGF, правильно процсс.
сируется сигнальной пептидазой E. coli, несмотря на изменение сайта про
цессинга по сравнению с OmpF. Чтобы проверить, влияет ли такое измо
нение на эффективность отщепления лндерного пептида, мы сконструиро
вали плазмиду pBTN-hEGF, которая отличается от pBT-hEGF наличием
последовательности, кодирующей 12 аминокислотных остатков N-концевой
части зрелого OmpF и дипеитид -LysLys- между этой последовательностью
и hEGF (рис. 2). В этой конструкции сайт процессинга сигнальной пен
тидазой соответствует природному, а дипептид -LysLys- предусмотрен как
сайт протеолитического расщепления при выделении целевого продукта
из гибридного белка.
Штамм JM105, трансформированный плазмидой pBTN-hEGF, выращи
вали в тех же условиях, что и JM105/pBT-hEGF, выделяли периплазма-
ти чес кую фракцию. Электрофорез белков в SDS-ПААГ показал наличие
768
RMBSPH
XPH
P s t l
Eco RI
фрагмент
Pstl-EcoRI
олигонуклеотида! (Щ) IJZ)
ТЧ-лига зп
Ps t l
f i i nd lE
lac
вектор __^
P s t l -ЩпйШ
_ фрагмент -*— lpUG18~hEEF
Eco Rl~MindM
. T Ч ~лигаза
Ш (Ш) XP R
360n.o. Sali
HPSB r
!*»*••. 3- Схема конструирования плазмид pU T hEC»F, рИ'ГЛ'Ы-л;!' я серии pBT(hEGF)«,
где П--2 4. Указаны сайты рестриктаз. R /?гоШ, М .''»»I. II ftamHI, S - Salt„
Р - Pill, I) • //¿ndllf. X A/toI. Светлые прямоугольники -участки, соответствуй
щи о гену ompFi заштрихованные участки, соответствующие гену liKCK. Зачернев
вый участок соответствует ¡2 кодовам N концевой части зрелого ОгмрК. Указано
положение промотора (1гыс или Piar) и области терминации транскрипции гена
rrnB (Т)
Продукция li.fOfif*' и пгрнллмзму м культуральную сроду
'I'о б лица /
II1; мм-il роду щ'нт
i I (III,'Г у KKGl
пс.гшплилма
, мг/jr культуры
(;реда
JM105/pBT-hEGF 3,5-4,5 1,0-2,0
JM 105/рВТ- (hEGF) г 9,5-10,5 3,0-3,5
JM105/pBT-(hEGFh 10,0-11,0 5,0-5.5
JM 105/рВТ-(hEGF) 4 9,0-10,0 6,0-7,0
JM105/pBTN-hEGF 10,0-12,0 1.5-2.0
в этом препарате белка с молекулярной массой примерно 8 кДа, что соответствует
теоретическому значению для правильно процессированного
гибридного белка OmpF-LysLys-hEGF. Присутствие hEGF-подобного
белка в периплазматической фракции JM105/pBTN-hEGF подтверждают
dot-метод с помощью антител на hEGF и иммуноферментный анализ. По
данным последнего, pBTN-hEGF обеспечивает секрецию целевого белка
в периплазму в количестве 10—12 мг/л бактериальной культуры (в расчете
на hEGF). Таким образом, изменение сайта процессинга в области начала
зрелого белка, а именно замена собственной последовательности
OmpF на чужеродную hEGF, приводит к снижению уровня секреции рекомбинантного
продукта более чем вдвое.
Как продуцент, штамм JM105/pBTN-hEG.F не выгоден для получения
hEGF, поскольку в нем в периплазму секретируется гибридный белок
OmpF-hEGF. Необходимость дополнительных стадий по - расщеплению
полипептидной цепи и разделению продуктов протеолиза является большим
недостатком этого штамма, несмотря на повышенный, по сравнению
с JM105/pBT-hEGF, уровень секреции рекомбинантного белка.
Плазмида pBT-hEGF, в которой ген лидерного пептида белка OmpF
точно состыкован с геном hEGF, более перспективна в биотехнологическом
плане, а повышения выхода целевого продукта можно добиться другим
путем — увеличением числа копий рекомбинантного гена. Мы
сконструировали серию плазмид pBT-(hEGF)„, где п—2—4. Для этого
фрагмент Xhol-Sall плазмиды pBT-hEGF клонировали по сайту рестрик-
тазы Sail в эту же плазмиду (см. рис. 2), затем тот же фрагмент Xho\-
Sall аналогично — в плазмиду pBT-(hEGF)2 и т. д. В этих конструкциях
с iac-промотора должны синтезироваться полицистронные мРНК, в которых
каждый цистрон будет транслироваться независимо.
Клетки E. col.i JM105, трансформированные плазмидами этой серии,
выращивали в тех же условиях, что и с плазмидой pBT-hEGF, выделяли
периплазматические фракции и исследовали их с помощью иммунофер-
ментного анализа. Результаты, представленные в табл. 1, показывают, что
при дупликации рекомбинантного гена количество hEGF в периплазме
возрастает и остается на том же уровне при 3 и 4 копиях гена, причем
этот уровень несколько ниже наблюдаемого в JM105/pBTN-hEGF. Увеличение
числа копий гена, однако, приводит к повышению экскреции hEGF
в культуральную среду. Количество белка, остающееся внутри клеток, не
оценивалось.
Штамм JM105/pBT-(hEGF)2 был использован для препаративного выделения
hEGF.
Препарат периплазматической фракции разбавляли в 2 раза водой и
доводили pH раствора до 3,0. При инкубации раствора (30 мин) наблюдалось
осаждение значительной части примесных белков, которые отделяли
центрифугированием (рис. 4, дорожка 3). Супернатант хроматографировали
с помощью ОФ гидрофобной хроматографии на колонке с
770
1 z 3 f4 5
Рис. ;î. Электрофореграммы периплазматической фракции белков в 15%
SDS ПАА1". 1 - штамм Ш105/рККП; 2 JM105/pBT-hEGF; 3 - JMlOó/pBT-
(hBGFh: 4 - JM105/pBT-(hEGF)3; 5 - JM105/pBT-(hEGF)*. В качестве
стандарта использовали набор белков-стандартов для электрофореза
(Pharmacia)
— 8 ,1
1 2 3 4 5
Рис. 4. Электрофорез препаратов h E O F на различных стадиях очистки:
1 клеточный лизат; 2 периплазматическая фракция; 3 •- осадок после
инкубации при pH 3,0; 4 - элюат с Davisil С,я; 5 - элюат с pBondopak Ci*
А
¿80
2,0
1,0
кцет о нитрил ,°/о
60
Л
/
/
/
/
/
/
/
/
/ 1
/ и
/
40
20
10 30
Время удерживания,
30
мин
Рис. 5. Разделение Ь В О Р па колопке с ¡хВош1орак Си. Скорость потока
4 мл,-мин
ПалпэЦ С,8. После нанесения препарата большая часть примесей удалялась
с колонки при промывке 30% метанолом, содержащим 0,1% ТРА.
Олюцию НЕС К проводили 50% раствором метанола, содержащим 0,1%
ТРА. На данной стадии достигалась высокая степень очистки йЕОР
(табл. 2), элюат содержал лишь минорные примеси балластных белков
(рис. 4, дорожка 4).
Для дальнейшей очистки препарат лиофидизировали и растворяли н
0,1% ТЕА. Полученный раствор содержал значительную часть примесных
денатурированных белков, которые отделяли центрифугированием.
Заключительную стадию очистки ЬЕОЕ проводили, используя
ОФ-ВЭЖХ па колонке с рВопс1орак С18. ЬЕСЕ элюировали с колопки линейным
градиентом ацетонитрила (0—60%) п 0,1% ТРА (рис. 5). Полученный
препарат ЬЕОР лиофилизиропали и хранили при —20° С. Результаты
очистки НЕСР приведены в табл. 2. Белок получен из периплазмы
К.соИ в состоянии, близком к гомогенному (>98%), с выходом 70%.
Представленный метод выделения позволяет получить до 7 мг ЬЕОР из
1 л бактериальной культуры.
По данным ЗБЗ-электрофореза, молекулярная масса ЬЕОЕ составляет
7 кДа. Результаты 25 циклов М-коицевого аминокислотного секвенирова
ния согласуются с известной последовательностью ЬЕСЕ.
Очистка ЬЕ ОК
Таблица
Стадии очистки Общий
»слои, мг
Общий
объем, мл
11 г Г', мг Чистота, % Выход. %
Периплазма 100 100 10 10 100
Суиернатант (pH 3,0) 80 2(Ю 9 11,3 !)0
1)а\'1,ч|| Г.|Ч 10 к; 7.5 75 75
цВопс!орак С (а 7 10 7 98 70
Рекомбинантный hEGF обладая выраженной биологической активностью
в тесте на раскрытие глаз новорожденных мьииой. Животные
открыли глаза: пешсъецированпые ыа 14-е сут, с, инъекциями мышиного
mEGF — на 8 —9-е сут, с инъекциями hEGF — па 10-е сут, что совпадает с
литературными данными для природного человеческого EG F [7].
Экспериментальная часть
В работе использовали трис, EDTA, акриламид, N.N'-метилеибисакрил-
амид, персульфат аммония, TEMED, ампициллин (Serva), агарозу, АТР,
бромистый этидий, IPTG (Sigma), мочевину, неорганические соли для
среды М9 квалификации ос. ч. или х. ч. (Союзреактин), агар, тринтон,
дрожжевой экстракт, казаминокислот'ы (Difco), Davisil (Chennnsl,).
Ферменты: Т4-полипуклеотндкиназа, Т4-ДНК-лпгаза (II ПО «Фермент
», Вильнюс), рестрикционные эндонуклеазы Л'соШ, /-’*/.[, Suu'.\\,
//md lll, Barn III, Sail, МВ-нуклеаза и ДНК-полимераза I (фрагмент Кленова)
производства PL Biochemicals. Поликлональные кроличьи антитела
к hEGF, биотинилированный hEGF и кон'ыогат стре 11 та пи д н и - 1 н* роке и да за
хрена предоставлены Э. Н. Цыциковым ( ВНИИбиотехнология).
Олигодезоксирцбонуклсотиды (5'~>-3' ) : GTTGCOА TCTTTGTTA Т A G А -
TTTCTGC (I), G A ATT С CGG А А ТТ G (II), AATTGGTGG AGGTGCA (III),
GCTGGAGG (IV), GC AGAAATGT AT А AC А А А (V). GATGGGA ACAAAGTAGATCTGAAAAAG
(VI), AATTCTTTTTCAGATCTACTTT (VII) -
были синтезированы как описано в работе [8].
Фосфорилироватше олигонуклеотидов, выделение фрагментов ДНК из
агарозных и полиакриламидных гелей, достраивание «липких» концов во
фрагментах ДНК, обработку растворов смесью фенол — хлороформ, осаждение
ДНК этиловым спиртом, лигирование, выделение ДНК рекомбинантных
клонов методом «быстрого лизиса» проводили как указано в руководстве
[91.
Обработку ДНК рестриктазами, МВ-нуклеазой и ДП К-нолммеразой 1
проводили в условиях, рекомендованных фирмами-нроизводителими ферментов.
Получение реципиентных клеток и их трансформацию осуществляли
но стандартной методике (10]. В качестве штамма реципиента использовали
E. coli JM105: A (lac ргоАВ) thi rpsL eudA sbcB15 hsdlVt (r m') /F'
ira 1)36 proAB lacl" AMI5 (Pharmacia).
Клетки E. culi выращивали в синтетической среде М9 |9] с добавлением
тиамина до 0,0005% и ампициллина до 20 мг/л. Трансформанты отбирали
па среде М9, содержащей 1,5% агара, 0,0005% тиамина и
50 мг/л ампициллина.
ДНК секвенировали по Максаму — Гилберту [11].
Периплазматическую фракцию клеточных белков выделяли как описано
в работе [121 -
Количественное содержание hEGF в периплазматической фракции определяли
с помощью иммуноферментного анализа (ELISA) [ 13].
Определение аминокислотной последовательности hEGF проводили на
газофазном секвенаторе фирмы Applied BiosysLems (USA) модели 477/V,
снабженном автоматическим анализатором фенилтиогидантононоп аминокислот
(модель 120А той же фирмы). Сухой образец растворяли в 25%
TFA, наносили аликвоты (3X30 мкл, суммарно 100—300 нмоль белка)
на фильтр реактора и высушивали каждую промежуточную аликвоту на
фильтре в токе инертного газа. После проведения 25 циклов отщепления
идентифицировали природу аминокислот.
Биологическую активность определяли, используя тест на индукцию
ускоренного раскрывания глаз при введении новорожденным мышам
KEG К [141. Новорожденных мышей линии СГ»7 ВI ./Й шгьецвронаяи рас
твором UEGF и течение парных пяти дней жизни (2 мкг/г веса). В ка
честве контроля параллельно наблюдали группу иепнъециропашшх мышей
(отрицательный контроль) и группу мышей, инъецированных природным
мышиным in EG F (положительный контроль). Фиксировали сроки
раскрытия глаз в опыте и контроле.
Pstl-Pst [-фрагмент гена Om pF выделяли с учетом известной рестрикционной
карты гена OmpF [10]. 150 мкг бактериальной геномной ДИК
.штамма E. coli С<Ю0, полученной по методике [1RJ, обрабатывали рестриктазами
SalI и Рун II. зону фрагментов длиной 3.5 — 4,0 т. п. о. выделяли из
0.7% агарозного геля. Полученную ДНК обрабатывало рестриктазами
ВатШ и Hindi 11 (их сайты отсутствуют в гене OmpF) и из агарозного
геля выделяли ту же зону. Далее ДНК обрабатывали рестриктазами
Ксо\\\ и Bgll 1. .чону (фрагментов длиной 1,0— 1,5 т. п. о. выделяли из 0.9%
агарозного геля и клонировали по сайтам указанных ростриктаз в плазмиде
pUC/18. Клоны, содержащие начало гена OmpF, выявляли гибридизацией
с радиоактивно-меченым олпгодезокепрнбонуклеотпдом (1) как
описано в статье [81. ДНК одного из полученных клопов обрабатывали
рестрнктазоп Pst], фрагмент длиной 180 и.о. выделяли из 8% ИААГ и
пере клонировали н pUC.18 по сайту /}$t\. Нуклеотидная последовательность
вставки, определенная методом Сзнгера с модификациями для плазмиды
[17), полпостьго соответствует последовательности соответствующей
области о т. pF [ 18) .
Замени дистального {по ходу трансляции) сайта Pst 1 (см. рис. 1). При
гидролизе фрагмента Patl-PstI длиной 180 и.о. рестриктазой SauSA образуются
2 фрагмента — 140 г! 40 и.о. Последний клонировали по сайтам
Psi I и Ват HI в векторе pUClBdelRI. который отличается от pUC18 отсутствием
сайта рестриктазы AcoRl и получен нами путем достройки
«липкпх» AcoR I-концов фрагментом Кленова в присутствии dATP и dTTP
(0.5 мМ каждый) с последующим лнгпрованием по «тупым» концам
1 мкг полученной плазмиды pUC 18delRI-^aH3A//->.s'iI«40». вставка которой
кодирует копе« лидерного пептида OmpF, обрабатывался рострыктазой
PstI. затем фрагментом Кленова в отсутствие дезокеннуклеотидтрифое-
фатов. Самокомплементарный олигодезоксирнбонуклеотпд (If) (0,25 мкг)
фосфорилпровали по а'- концу с помощью Т4-полинуклеотндкиназы и
г.АТР, отжигали (понижение температуры от 85 до 20° С в течение 2 ч)
и легировали с полученной ДНК. Лнгазную смесь выдерживали при
70" С 15 мин, обрабатывали рестри ктазой Есо)\\ (50 од. акт., 4 ч) для
выщенлепия короткого участка синтетического олигонуклеотида между
двумя сайтами этой рестриктазы и высокомолекулярную ДНК осаждали
0,1% цетп лтримитил а м мои ий бромидом. Далее проводили лигирование
(П.1 мкг ДНК и 50 мкл) и трансформацию рецпниептных клеток штамма
JМ105. Плазмиды, выделенные из амннцнллин-устойчивых клонов, проверяли
на наличие сайта рестриктазы AcoRI и секвеннровалп но методу
Ма ксама — Гилберта. Полученную таким образом плазмиду pUClBdeJRISau?>
A/Eco]\I «40» гидролизовали рестриктазами Sau ЗА и A’coRI и фрагмент
длиной 40 и.о. выделяли из 12% ПЛАТ. Далее лигировалн выделенные
фрагменты ( 140 и 40 и.о.) с вектором рОС 18/Â’coRl/Pstl п полученной
плазмидой трансформировали рециниентные клетки JM105. Структуру
полученной плазмиды pUCiB-OrapF(PsÜ/ЕсоШ ) подтверждали рестрикционным
анализом и секвенировапием области, включающей ompF,
метолом ( ’.зпгера.
¡конструирование плазмиды pKKD. ДНК' коммерческой плазмиды
рКК228-8 обрабатывали рестриктазами AcoRI и Pstl и векторный фрагмент
выделяли ив 0,9% агарозного геля. Олигодезокснрибопуклеотиды
(III) и (IV) отжигали в зквимолярных количествах (от 60 до 20° С в
течение 2 ч) и лигировали с вектором в молярном соотношении 50:1.
После трансформации реципиентных клеток JM105 была получена плазмида
pKK-XhoI. ДНК этой плазмиды обрабатывали рестриктазой ВатШ1,
«липкие» концы достраивали с помощью фрагмента Кленова и смеси четырех
дезоксинуклеотидтрифосфатов и лигировали ДНК по «тупым концам
». Далее проводили трансформацию клеток JM105 и отбор плазмид,
не содержащих сайта Bamlil. Элиминацию сайта рестриктазы Sail в полученной
плазмиде проводили аналогично. Схема образовавшейся плазмиды
pKKD приведена на рис. 2.
Конструирование плазмиды pBT-hEGF (см. рис. 2). ДНК плазмиды
pUC18-OmpF(/)sn / J6’coRI) обрабатывали рестриктазами Pstl и £coRI,
ДНК плазмиды pUC18-hEGF — рестриктазами jEcoRI и Hindlll. Фрагменты,
содержащие гены ompF и hegf (оба примерно 180 п. о.) выделяли из
8% ПААГ. ДНК плазмиды pKKD обрабатывали рестриктазами Pstl о
//¿«dill и векторный фрагмент выделяли из 0,9% агарозного геля. Выделенные
фрагменты лигировали в эквимолярном соотношении. .Лигазной
смесью трансформировали реципиентные клетки JM105. Структуру полученной
плазмиды pBT-hEGF подтверждали рестрикционным анализом и
ееквенированием гибридного гена методом Сэнгера.
Конструирование плазмиды рВТ N-hEGF (см. рис. 2). ДНК плазмиды
pBT-hEGF обрабатывали рестриктазами icoRI и и фрагмент, несущий
ген hegf, выделяли из 8% ПААГ. Олигодезокснрибонуклеотиды
(I), (V)—(VII) (по 5 пмоль) фосфорилировали по 5'-концам с помощью
Т4-полинуклеотидкиназы и гАТР и отжигали при температуре от 80 до
20° С в течение 4 ч. В смесь добавляли 1,5 пмоль фрагмента £coRI-
.//mdlll, 1/10 объема 10-кратного лигазного буфера, 2 ед. акт. Т4-ДНК-ли-
газы и лигировали 2 ч при 14° С. Раствор обрабатывали смесью фенол —
хлороформ (1 :1 ) и ДНК осаждали спиртом. Далее ДНК расщепляли рестриктазой
i/irtdlll и выделяли из 8% ПААГ фрагмент, содержащий последовательность
12 кодонов N-концевой части зрелого ornpF, кодонов
дипептида -LysLys- и гена hegf (230 п. о.). ДНК плазмиды pBT-hEGF
обрабатывали рестриктазой £coRI и «липкие концы» удаляли МВ-нукле-
азой. После обработки смесью фенол — хлороформ (1 : 1) ДНК расщепляли
рестриктазой #md I I I и векторный фрагмент выделяли из агарозного
геля. Затем полученную ДНК лигировали с фрагментом (230 п. о.) в соотношении
3 :1. Клоны, несущие синтетический фрагмент, выявляли гибридизацией
с радиоактивно-меченым олигонуклеотидом (I) как описано
в работе [8]. Плазмиду с правильной структурой отбирали после секвени-
рования методом Максама — Гилберта.
Конструирование серии плазмид pBT-(hEGF) „ (см. рис. 2). ДНК плазмиды
pBT-hEGF обрабатывали рестриктазами Sail и Xhol и фрагмент гибридного
гена (360 п. о.) выделяли из 1,5% агарозного геля. Выделенный
фрагмент лигировали с плазмидой pBT-hEGF, обработанной рестриктазой
Sail. Правильность ориентации фрагмента Sall-Xhol в плазмиде рВТ-
(hEGF)2 определяли после гидролиза рестриктазами Sail и Xhol по размеру
образующегося фрагмента. Плазмиды с 3 и 4 копиями гена hegf получены
аналогично.
Выделение hEGF. Периплазматическую фракцию получали как описано
в работе [12]. Из 1 л бактериальной культуры было получено 100 мл
препарата в буфере, содержащем 1 М трис-HCl, pH 9,0; 2 мМ EDTA.
Для очистки hEGF препарат периплазматической фракции разбавляли в
два раза водой при перемешивании и доводили рИ до 3,0 2 н. НС1. После
30 мин инкубации и центрифугирования (12 000^, 30 мин) супернатант
наносили на колонку (5X2 см) с Davisil С18 (90—130 мкм), уравновешенную
10% метанолом (1 объем). Колонку последовательно промывали 10%
метанолом (1 объем) и 30% метанолом (2 объема), содержащим
775
0,1% TFA. hEGF элюировали 3 объемами 50% метанола, содержащего
0,1% TFA, при скорости потока 4 мл/мин. Элюат лиофилизовали с немощью
Speed-Vac (Savant) и проводили заключительную стадию очистки
с помощью ОФ-ВЭЖХ. Препарат растворяли в 0,1% TFA и наносили на
колонку u Bondopak С„ (0,78X30 см) фирмы Waters. hEGF элюировали
с помощью линейного градиента концентрации ацетонитрила (20—60%)
я 0,1% TFA. Ия всех стадиях очистки тестирование hEGF осуществляли
с помощью SUS-электрофореза и иммуноферментного анализа.
С П И С О К Л И Т Е Р А Т У Р Ы
1. Medicai World News. J088. V. 1.1 Л 10. P. 17. P. 3580-3593.
2. Jim ‘lUKOda II. В., ('канцона И. В. . Твардовская С. £., Бесидский E. С., Дань-
коа 10. В., Степана* А. П., Ажаеа А. В. // Биоорган, химии. 1988. Т, 14. № 5,
С. 621 630.
3. Matsuyama S. ./., Мiianu Т., Mizushima S. // J. Bacterid 1986. V. 168. № 3. P. 1309-
1311
4. Os trow К. S.. S ilka ay T. J., Garrett S. // J. Bacteriol. 1986. V. 168. № 3. P. 1165 -1171.
5. Heyde М., Portal,e, R Ц Mot. Gen. Genet. 1987. V. 208. № 3. P. 511-517.
(j. l. uokkamaki М., Pal »a E. Т. Ц F E M S Microbiol. Lett. 1987, V. 40. № 1. P. 21-25.
7. Ohgai H., Kamakura Т., Komoto S., Matsuo YO h s h i d e n К , Koide T ., Yanaihara С.
Vanaiharo S . ¡1). Biotechnol. 1989, V. 10. 2. P. 151-160.
8. Кулагина М. А.. Скапц.опа H. В., Во„гчикова И. В., Куркин, А. //., Ажаен А. В.Ц
Биоорган, химия. 1990. Т. 16. № 5. С. 625-634.
S). Maniatix Т., rrUsvh Е. Е., Sambronk 1. Ц Molecular Cloning. A Laboratory Manual.
CSH Lab. 1982.
Ю. Cohen С. A'., Chang A. C. > ., Hsu L. II I’roc. Nat. Acad. Sci. USA. 1972. V. 69. № 8.
P. 2110-2114.
11. Vaxam A. M„ Gilbert W. // Proc. Nat.. Acad. Sci. USA. 1977, V. 74. № 2. P. 560-564.
12. Engler I). A., Mo-tsunami It, A., Campion S. R.. Stringer С D., Stevens A .
Niyogi S. K. Hi . Biol. Chem. 1988. V. 263. № 25. P. 12384-12390.
13. Bosk A. M. 0.. Van Hell //., Brands Y Sch.uu.rs A. H. W. М. 11 Enzyme Labeled Immunoassay
of Hormones and Drugs / Ed.. S. B. Pal. B.: Water de Gruyter, 1979.
P. 175 -187.
14. Allen Cl,, Winther М. O., Ilenwood G. H., Beesley $ harry L. F O ’Keefe /., Bennett
J. И'., Chapman R. E., Hellish, D. E,, Panaretto В A.. Van Dooren P., Edots R. W
¡nglis A. S., Wynn P C.. Moore G. P. M. f f i . Biotechnol. 1987. V. 5. № 2, P. 93-114.
55. MuLoh /V /7 1'EBS Lett. 1982. V. 137. № 2. P. 171- 174.
16. Pilcher J., Sounder K. //Lett. Appl. Microbiol. 1989. V. 8. № 4 P. 151-156.
17. Краге А. С.Ц Молекуляр. биология. 1988. T 22. № 5. С. 1164-1197.
18. Inokushi Л., Muton /V., Mat suyama S., Mizushima S. I/ Nucl. Acids Res. 1982. V. 10.
Л» 21. P. 6957- 6968.
Поступила в редакцию
19. IX. 1991
После доработки
27.1.1992
N. V. BATCHIKOVA, I B. ALTMAN, S. V. LUTSENKO. V. A. SMIRNOV,
I V N AZIMOV*, L. O. E SH KIN O , E. A. S IN Y A G IN A , A. V. AZHAYEV
SECRETION O F R E C O M U ! N A N T H U M A N E P I D E R M A L G R O W T H F A C T O R
INTO P E R I P L A S M O F E. COLl CELLS
«Ch im tech» Ltd, Mosco w;
*M ,1/. Skemyak in Institute of Bit-organic Chemistry, Russian A c a d em y of Sciences, Moscow
Secretion vectors were constructed in which a synthetic gene of human epidermal
growth factor (hEGF) joined with a gene coding for the leader peptide to one of the
E. coli outer membrane major proteins (OmpF) is controlled by tac promoter. The increase
of the h E G F yield was achieved by the multiplication of the gene copies
The h E G F in bacterial cells was secreted into periplasm. The recombinant protein was
isolated by means oS reverse phase chromatography as almost homogenous preparation
i '98 /0 ). the yield being 7 mg/1 bacteria) culture. The sequence of twenty-five N-terminal
amino acid residues of the isolated h E G F coincided with that of the natural protein.
The preparation proved to be biologically active.
776

Комментировать