ИДЕНТИФИКАЦИЯ УЧАСТКА ГЕНА РЕЦЕПТОРА ВЕЩЕСТВА Р В ГЕНОМНОЙ ДНК ЧЕЛОВЕКА С ПОМОЩЬЮ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ

Читать онлайн: 
Текст статьи: 

Б И OOP ГАНИЧЕ СКАЯ ХИМИЯ
Т о м 18 * № 5 * 1 9 9 2
ЛИСЬМА РЕД АК ТОРУ
УДК 577.214.3
© 1992 г. А. А. Баринов, А. Б. Курятов, И. Б. Мерцалов,
. [ .О. Марцен, В. И. Цетлин
Институт биоорганической химии им. М. М. Шемякина РАН, Москва
Вещество Р и родственные пептиды образуют семейство так называемых
тахикининов (нейрокининов), обладающих широким спектром
биологической активности: эти пептиды влияют на сократимость гладкой
мускулатуры, выполняют роль нейромедиаторов, участвуют в проведении
болевых сигналов, оказывают влияние на уровень классических нейромедиаторов
и цитокинов (см. обзоры [1, 2]). Преобладающая часть перечисленных
эффектов на нервную и иммунную системы реализуется благодаря
взаимодействиях! с тахикининовыми рецепторами. В настоящее
время различают три основных типа тахикининовых рецепторов — NK-1,
NK-2 и NK-3, которые проявляют наиболее высокую специфичность
соответственно к веществу Р, нейрокинину А (синоним: вещество К)
и нейрокинину В (синоним: нейромедин К) [3]. Функциональные исследования
и установленные нуклеотидные последовательности генов всех
трех типов белков [4—8] свидетельствуют об их принадлежности к семейству
G-белокзависимых рецепторов.
Для выяснения структурно-функциональных взаимоотношений тахикининовых
рецепторов несомненный интерес представляет установление
структур возможно большего количества белков этого семейства, в том
числе и рецепторов человека. Эта задача крайне сложна из-за чрезвычайно
низкого содержания как соответствующих мРНК, так и экспрессированных
рецепторов. Следует отметить, что ни один из тахикининовых
рецепторов как белок не был выделен в индивидуальном виде, а первая
нуклеотидная последовательность гена рецептора (NK-2 из кишечника
быка) была установлена с использованием функциональной экспрессии
в ооцитах Xenopus [4]. Попытки нескольких лабораторий использовать
олигонуклеотидные зонды, сконструированные на основе этой
последовательности, для идентификации новых представителей тахикининовых
рецепторов оказались безуспешными; любопытно, что при этом
была установлена последовательность G-белокзависимого рецептора кап-
набиноидов [9].
Появление метода полимеразной цепной реакции (ПЦР или ампли-
ф (кации in vitro) (см. обзор [10]), значительно упростило идентификацию
и установление структур генов, принадлежащих к одному семейству.
Так, недавно с помощью ПЦР и праймеров, синтезированных на
основе нуклеотидной последовательности гена рецептора NK-2 из кишечника
быка, при использовании мРНК из трахеи человека был получен
фрагмент кДНК, давший затем возможность идентифицировать в геномной
библиотеке ДНК человека клон полноразмерного рецептора NK-2 (8).
В настоящей работе ПЦР использована для идентификации гена
рецептора вещества Р (рецептора NK-1} в геноме человека. Нами были
синтезированы пары праймеров, нуклеотидные последовательности которых
идентичны участкам консервативных облаете!! ДНК рецептора
вещества Р и а мозга крысы. В рамках существующих моделей пространственной
организации тахикининовых рецепторов [7] эти участки отвечают
аминокислотным последовательностям трансмембранкых фрагментов.
Амплификация проводилась на матрице геномной ДНК из мозга человека,
предварительно обработанной рестриктазой Eco RI в следующих
условиях: денатурация (93° С, 30 с), отжиг (55° С, 3 мин), элонгация
(74° С, 2 мин), интервал между сменами температур цикла — 30 с, количество
циклов — 25.
Полученные продукты ПЦР анализировали с помощью электрофореза
в 2% агарозном геле с добавлением бромистого этидия до конечной концентрации
0,5 мкг/мл.
Положительные результаты были получены при использовании пары
олигонуклеотидных праймеров spS3 и spA4:
s p S 3 5 ' ACCTTCGCCÄTCTGCTGGCTGCCCT 3 '
s pA 4 5 ' GCCAGGTAGACCTGCTGGATGAACTT. 3 '
Фрагменты, близкие по размерам к теоретически ожидаемым
( — 100 п. о.). сорбировали в агарозном геле на бумагу NA-45 (Schleicher
und Schüll). Элюция проводилась в 100 мкл буфера: 1 мМ EDTA, 10 мМ
трис-НС1 (pH 7,4), 1 М NaCl. Выделенные фрагменты достраивались до
тупых концов фрагментом Кленова в стандартных условиях — в присутствии
четырех dNTP, в среднесолевом рестриктазном буфере (10 мМ трис-
HGI (pH 7,4), 50 мМ NaCl, 10 мМ MgCl2, 1 мМ дитиотреит) — 30 мин
при 37° С. Затем образцы прогревались при 70° С 10 мин. Клонирование
осуществлялось но рестрикционному сайту EcoRV в экспрессирующийся
вектор pBlne script II (Stratagene, USA). Это фагмидный вектор, разра-
ботанный для процедур клонирования, секвенирования, наработки РНК-
транскриптов in vitro, сайт-специфического мутагенеза и генетического
картирования. При клонировании и выделении ДНК использовали штамм
E. coli XL-1 Blue. Были отсеквенированы пять независимых клонов с
длиной вставки 87—94 п. о., последовательности которых идентичны в
области перекрывания. Приведенная ниже последовательность отвечает
клону с наибольшей длиной вставки.
Анализ полученного фрагмента
CGCCÄTCTGCTGGCTGCCCTTCCACATCTTCTTCCTCCTGCCCTACATCAACCCAGATCTCTACCTGAA
----------------------------- *■-
_____ SES3 ____________________________ ]
V I
GAAGTTCATCCÄGCAGGTCTACCTG
spA 4
V I I
показал его совпадение с участком 771—864 нуклеотидной последовательности
рецептора вещества Р из мозга крысы, за исключением одной за-
741
1 A I С w L P Y H Y Y F I L T A I Y Q Q L N E w
2 A r с w L P Y H L Y F I L G T F Q F D I Y С H
3 A I с w L P Y H L Y F I L G T F 0 F D I Y С H
4 A I с w L P Y H L Y F I L G s F Q E D I Y с H
K Y I Q Q V Y L A
K F I Q Q V Y L A
K F I Q Q V Y L A
K F I Q Q V Y L A
A I C W L P F H V F F L L P Y I N P D L Y L K K F I Q Q V Y L A
A I С И L P F HjT] F P L L P Y I N P D L Y L K K F I Q Q V Y L A
VI - !------VU--
Сравнение аминокислотных последовательностей фрагментов тахикининовых рецепторов:
1 - рецептор КК-З из мозга крысы [7]; 2, 3, 4 - рецепторы МК-2 из мозга крысы,
быка и человека [5, 4, 8]; 5 - рецептор 1ЧК-1 из мозга крысы ¡6]; 6 - фрагмент
рецептора 1ЧК-1 человека, проанализированный в настоящей работе. В рамку заключены
гомологичные участки
мены — G795 на А (выделена жирным шрифтом, римскими цифрами
обозначены границы трансмембранных фрагментов в соответствующей
аминокислотной последовательности), т. е. замены Val на Ile в аминокислотной
последовательности (рисунок).
Интересно, что так же, как и в случае рецептора NK-2 человека [8],
в нуклеотидной последовательности, кодирующей трансмембранные фрагменты
VI и VII, отсутствуют интроны.
Сравнение имеющихся в литературе полных аминокислотных последовательностей
тахикининовых рецепторов (см. [7]) показывает, что из
трансмембранных фрагментов наиболее консервативен для всего семейства
фрагмент VII. Входящие в него остатки, как правило, инвариантны
(идентичны) в рецепторах одного типа из разных источников. Это видно
и из рисунка для приведенной части фрагмента VII. Более высокая
вариабельность характерна для фрагмента VI, и именно здесь локализуется
обнаруженное нами отличие (Val —Ile). Петля, соединяющая
трансмембранные фрагменты VI и VII, вообще не содержит остатков,
инвариантных во всех подтипах рецепторов. С другой стороны, из рисунка
видно, что для рецепторов одного подтипа из разных источников (например,
NK-2 из крысы, быка и человека) последовательность в пределах
этой петли достаточно инвариантна. Следует упомянуть и высокую
степень гомологии внутри других семейств G-белокзависимых рецепторов
(ос- и ß-адренергических, мускариновых, ацетилхолиновых и др.),
однако гомология между представителями разных семейств даже в области
трансмембранных фрагментов, как правило, не превышает 35%.
Таким образом, изложенные литературные данные и анализ рисунка
позволяют сделать вывод о том, что установленная нами нуклеотидная
последовательность отвечает тахикининовым рецепторам и является
фрагментом гена рецептора вещества Р.
Авторы выражают благодарность Н. С. Быстрову за синтез олиго-
нуклеотидных зондов.
С П И С О К Л И Т Е Р А Т У Р Ы
1. Pernow В, И Pharmacol. Rev. 1983. V. 35 № 2. P. 85-141.
2. Kimball E. S. Ц Ann. N. Y. Acad. Sei. 1989. V. 594. P. 293-308.
3. Quirion R., Dam. T, V. // Reg. peptides. 1988. V. 22. P. 18-25.
4. Masu Y., Nakayama K., Tamaki H., Harada Y., Kuno M., Nakanishi S. / / Nature. 1987.
V. 329. № 6142. P. 836-838.
5. Sasai У., Nakanishi S. // Biochem. and Biophys. Res. Communs. 1989. V. 165. № 2.
P. 695-702.
742
6. Yokota Y-, Sasai V., Tanaka K., Fujiwara Т., Tsuchtda K., Shigemoto H., Kaki zuka Д.,
Ohkabo H„ Nakanishl S . / / J . Biol. Chem. 1989. V. 264. № 30. P. 17649-17652.
7. Shigemoto R., Yokota Y., Tsuchtda K., Nakanishl S. // 5. Biol. Chem, 1990. V. 265.
№ 2. P. 623-628.
8. Gerard N. P., Eddy P. L., Jr., Shows T,. B., Gerard C . / /L Biol. Chem. 1990. V. 265.
№ 33. P. 20455-20462.
9. Matsuda L. A., Lolait S. Brownstein М. I., Young A. €., Bonner T. /.//Nature.
1990. V. 346. № 6284. P. 561-564.
10. Bloch W . / l Biochemistry. 1991. V. 30. № 11. P. 2735-2745.
11. Lefkowi tz R. /.//Nature. 1991. V. 351. № 0325. P. 353-354.
Поступило в редакцию
15.1.1992
A. A. BARINOV, A. B. KURVATOV, I. B. MERTSALOV, ),. o . MARTSEN,
V. I . T S E T U N
IDENTIFICATION O F A F R A G M E N T O F T H E S U B S T A N C E P R E C E P T O R
G E N E IN H U M A N G E N O M I C D N A W I T H T H E AI D O F P O L Y M E R A S E
C H A I N R E A C T I O N
M .M . S'hemyakin Institute of Bioorganic Chemistry, Russian Academy of Sciences,
Moscow
Polymerase chain reaction was applied to human genomic N D A using primers corresponding
to the rat substance P receptor cDNA. As a result, a fragment of 94 b. p. was
isolated identical to the fragment 771-864 of the above-mentioned cDNA, with the exception
of the G 796-+A substitution (Val-*Ile in the amino acid sequence). A comparison
i)f the established sequence with the published structures of tachykinin receptors of NK-1,
2VK-2 and NK-3 types allows its assignment to the substance P receptor (NK-1 tachykinin
receptor) gene detected in the human genome.
743

Комментировать